View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3562_high_22 (Length: 219)

Name: NF3562_high_22
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3562_high_22
NF3562_high_22
[»] chr7 (2 HSPs)
chr7 (86-202)||(38949540-38949656)
chr7 (18-46)||(38949696-38949724)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 86 - 202
Target Start/End: Complemental strand, 38949656 - 38949540
Alignment:
86 gagaactaaggcttagatgcctttactcgagtcatgtaccttttgcggaaacagaataaacaaaaagcgaaatttcaaatggtttatgattttctgtcaa 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38949656 gagaactaaggcttagatgcctttactcgagtcatgtaccttttgcggaaacagaataaacaaaaagcgaaatttcaaatggtttatgattttctgtcaa 38949557  T
186 agtttgtgtgttctgtg 202  Q
    |||||||||||||||||    
38949556 agtttgtgtgttctgtg 38949540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 38949724 - 38949696
Alignment:
18 agagctgcagcttaaatttgacaccaatc 46  Q
    |||||||||||||||||||||||||||||    
38949724 agagctgcagcttaaatttgacaccaatc 38949696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University