View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_high_23 (Length: 204)
Name: NF3562_high_23
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 39 - 189
Target Start/End: Complemental strand, 43086119 - 43085970
Alignment:
| Q |
39 |
aataatactcacgagttcaagttattcaaatctcatctacaattaagaaagaatgattgagaatatggttttcattgaataactgtgtggggggaatctt |
138 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43086119 |
aataatactcacgagttcgagttattcaaatctcatctacaattaagaaagaatgattgagaatatggttttcattgaataactgtg-ggggggaatctt |
43086021 |
T |
 |
| Q |
139 |
tagtgtcagggaacacactttatgtcttcctcctgtttcacgtacgatgat |
189 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
43086020 |
tagtgtcagggaacacagtttatgtcttcctcctgtttcacgtactatgat |
43085970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University