View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_high_9 (Length: 333)
Name: NF3562_high_9
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 39937012 - 39936795
Alignment:
| Q |
1 |
tgcataacacaacttaatgtccactggcatccaaacatattatcatgaacatcacgaacgcaaaatcaatttttagatctaaatttaaaatttaaaataa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
39937012 |
tgcataatacaacttaatgtccactggcatctaaacatattatcatgaatatcacgaacgcaaaatcaa-ttttagatctaaatttaaaatttaaaatga |
39936914 |
T |
|
| Q |
101 |
gtttggcttgcta-tatgtccttctgtgctcttctccagtgagagttcatgttatgaatttcnnnnnnngttcaaaggatgaatcgaaaattaattaaaa |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||| ||| |
|
|
| T |
39936913 |
gtttggcttgctattatgtccttctgtgctcttctccggtgagagttcatgttatgaatt---attatttttcaaaggatgaataaaaaattaattgaaa |
39936817 |
T |
|
| Q |
200 |
atggatttagtttgttatatga |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39936816 |
atggatttagtttgttatatga |
39936795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 39936783 - 39936738
Alignment:
| Q |
280 |
ccacaattgct-catatttgtgttgagtaattgaaagtgatgatgt |
324 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39936783 |
ccacaattgctgcatatttgtgttgagtaattgaaagtgatgatgt |
39936738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 20209017 - 20209062
Alignment:
| Q |
176 |
ggatgaatcgaaaattaattaaaaatggatttagtttgttatatga |
221 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||| ||||||||||| |
|
|
| T |
20209017 |
ggatgaatagaaaattaattgaaaatgggtttagcttgttatatga |
20209062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University