View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_low_16 (Length: 250)
Name: NF3562_low_16
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 12295513 - 12295754
Alignment:
| Q |
1 |
acactgtttactatcgtttaagaatcattgtttactaaaattaggccatttttagaggttttaagacggcttccgacttgaaggttaattttttgaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12295513 |
acactgtttactatcgtttaagaatcattgtttactaaaattaggccgtttttagaggttttaagacggcttccgacttgaaggttaattttttgaaaag |
12295612 |
T |
 |
| Q |
101 |
tttttagttgcagtaaatgttgatcaaaggtttttggaaatagcgtgtgatttcttaaattgtgctcaaagagttatttcgtttaattacttggggttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12295613 |
tttttagttgcagtaaatgttgatcaaaggtttttggaaatagcgtgtgatttcttaaattgtgctcaaagagttatttcgtttaattacttggggctac |
12295712 |
T |
 |
| Q |
201 |
cggggtaaatccgaggaagatctctacgtgggagcctatgtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12295713 |
cggggtaaatccgaggaagatctctacgtgggagcctatgtt |
12295754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University