View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_low_19 (Length: 241)
Name: NF3562_low_19
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 9783646 - 9783870
Alignment:
| Q |
1 |
ttgaaagaaaatctaaaagttgaaggtatcttggggataaatagccgaaggaactgcaagatcattgaataattgaaggatttgtgttcaagtctcaagg |
100 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||| |
|
|
| T |
9783646 |
ttgaaagaaaattttaaagttgaaggtattttggg-ataaatagccgaaggaactgcaagatcattgaataattgaaggatttgtgtttaagttttaagg |
9783744 |
T |
 |
| Q |
101 |
actgggattttgttagaggagattagttcaaga--attttaannnnnnnnnatgcaatttagttcaagaattataacctagacttttggtggctaattgt |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9783745 |
actgggattttgttagaggagtttagttcaagattttttttttttttttttatgcaatttagttcaagaattataacctagacttttggtggctaattg- |
9783843 |
T |
 |
| Q |
199 |
atatgtataaactcataagcactttgtg |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9783844 |
-tatgtataaactcataagcactttgtg |
9783870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University