View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_low_21 (Length: 236)
Name: NF3562_low_21
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12295394 - 12295173
Alignment:
| Q |
1 |
tttactgcccacgtcctctagttcaatatatggtatgggcgttgctttatcatgttggagagcctttgcttgaattactggcctttttcgaagcttagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12295394 |
tttactgcccacgtcctctagttcaatatatggtatgggggttgctttatcatgttggagagcctttgct-gaattactggcctttttcgaagcttagac |
12295296 |
T |
 |
| Q |
101 |
atagttcattacaaattgcaataaatcatatacgttatgaggatgaaaatggaagatatattggggttggaagtgcagtgaaggtaatttagaaataata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12295295 |
atagttcattacaaattgcaataaatcatatacgttatgaggatgaaaatggaagatatattggggttggaagcgcagtgaaggtaatttagaaataata |
12295196 |
T |
 |
| Q |
201 |
ctatagtgttcgagttataactg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12295195 |
ctatagtgttcgagttataactg |
12295173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 146
Target Start/End: Complemental strand, 35183566 - 35183443
Alignment:
| Q |
22 |
ttcaatatatggtatgggcgttgctttatcatgttggagagcctttgcttgaattactggcctttttcgaagcttagacatagttcattacaaattgcaa |
121 |
Q |
| |
|
||||| ||||| |||||| || |||||||| || ||||||||||| || ||||| ||||||||| | ||||||||||| | ||||| ||||||||| |
|
|
| T |
35183566 |
ttcaagatatgttatggggatttctttatcacgtgggagagccttttct-gaattgctggcctttcaccaagcttagacagaaggcattagaaattgcaa |
35183468 |
T |
 |
| Q |
122 |
taaatcatatacgttatgaggatga |
146 |
Q |
| |
|
| |||||| | |||| |||||||| |
|
|
| T |
35183467 |
ttaatcatgtgggttacgaggatga |
35183443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University