View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3562_low_22 (Length: 219)
Name: NF3562_low_22
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3562_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 86 - 202
Target Start/End: Complemental strand, 38949656 - 38949540
Alignment:
| Q |
86 |
gagaactaaggcttagatgcctttactcgagtcatgtaccttttgcggaaacagaataaacaaaaagcgaaatttcaaatggtttatgattttctgtcaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38949656 |
gagaactaaggcttagatgcctttactcgagtcatgtaccttttgcggaaacagaataaacaaaaagcgaaatttcaaatggtttatgattttctgtcaa |
38949557 |
T |
 |
| Q |
186 |
agtttgtgtgttctgtg |
202 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38949556 |
agtttgtgtgttctgtg |
38949540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 46
Target Start/End: Complemental strand, 38949724 - 38949696
Alignment:
| Q |
18 |
agagctgcagcttaaatttgacaccaatc |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38949724 |
agagctgcagcttaaatttgacaccaatc |
38949696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University