View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3562_low_23 (Length: 204)

Name: NF3562_low_23
Description: NF3562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3562_low_23
NF3562_low_23
[»] chr8 (1 HSPs)
chr8 (39-189)||(43085970-43086119)


Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 39 - 189
Target Start/End: Complemental strand, 43086119 - 43085970
Alignment:
39 aataatactcacgagttcaagttattcaaatctcatctacaattaagaaagaatgattgagaatatggttttcattgaataactgtgtggggggaatctt 138  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
43086119 aataatactcacgagttcgagttattcaaatctcatctacaattaagaaagaatgattgagaatatggttttcattgaataactgtg-ggggggaatctt 43086021  T
139 tagtgtcagggaacacactttatgtcttcctcctgtttcacgtacgatgat 189  Q
    ||||||||||||||||| ||||||||||||||||||||||||||| |||||    
43086020 tagtgtcagggaacacagtttatgtcttcctcctgtttcacgtactatgat 43085970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University