View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3563_high_3 (Length: 329)
Name: NF3563_high_3
Description: NF3563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3563_high_3 |
 | |
|
| [»] scaffold0076 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0076 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 205 - 279
Target Start/End: Complemental strand, 57183 - 57109
Alignment:
| Q |
205 |
gatgttgtgattgatgtttggttgaaaatttcatgttttttatctatcatatgtgaatcctcatagatttgtata |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
57183 |
gatgttgtgattgatgtttggttgaaaatttcaggttttttatctatcatatgtgaatcctcatggatttgtata |
57109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 89
Target Start/End: Complemental strand, 59371 - 59317
Alignment:
| Q |
35 |
tgtagtgagtttagctcaaatatctcacactgcttataattatctacgcatgaat |
89 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
59371 |
tgtaatgagtttagctcaaatatctcacactgcttgtaattatctactcatgaat |
59317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 88 - 132
Target Start/End: Complemental strand, 57291 - 57247
Alignment:
| Q |
88 |
atgaaggatccatcttcacttgtattttatccacttatcgtgatt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
57291 |
atgaaggatccatcttcacttgtattttatccacatatcgtgatt |
57247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 89
Target Start/End: Complemental strand, 51075054 - 51074999
Alignment:
| Q |
34 |
atgtagtgagtttagctcaaatatctcacactgcttataattatctacgcatgaat |
89 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
51075054 |
atgtaatgaatttagctcaaatatctcacactgattgtaattatctactcatgaat |
51074999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University