View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3564_high_10 (Length: 418)
Name: NF3564_high_10
Description: NF3564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3564_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 292
Target Start/End: Complemental strand, 10820303 - 10820015
Alignment:
| Q |
8 |
atcatcacatacaagaaaactaaatctttggtcaagtttggtaggcaaaggaattttggaatccaaataatcaatgttatgcagtaaagtggatcaagca |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820303 |
atcataacatacaagaaaactaaatctttggtcaagtttggtaggcaaaggaattttggaatccaaataatcaatgttatgcagtaaagtggatcaagca |
10820204 |
T |
|
| Q |
108 |
aacaagaagctcttgcta----ctatcatactatgcacttatgcagtacgtgttcaatatgtttagacacctaaaatnnnnnnncttagtgtgacctttt |
203 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10820203 |
aacaagaaactcttgctaccatcaatcatactatgcacttatgcagtacgtgttcaatatgtttagacacctaaaataaaaaaacttagtgtgacctttt |
10820104 |
T |
|
| Q |
204 |
ttggtgtgaatcaggtatcttttgtatgcaactataaaggttaatctatcgagccgggtagaaccataaataaattttattgtgagacc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10820103 |
ttggtgtgaatcaggtatcttttgtatgcaactacaaaggttaatctatcgaaccgggtagaaccacaaataaattttattgtgagacc |
10820015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 359 - 403
Target Start/End: Complemental strand, 10819959 - 10819915
Alignment:
| Q |
359 |
gcctcaccactatgacctcatgattcctctcattgccatgtgaat |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10819959 |
gcctcaccactatgacctcatgattcctctcattgccatgtgaat |
10819915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University