View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3564_high_29 (Length: 257)
Name: NF3564_high_29
Description: NF3564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3564_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 35208962 - 35208728
Alignment:
| Q |
1 |
gaaaggattcaagtatatggtaccaaccttggctagttggcttcgtatcttggcaacaactactcatcatttggagtgtccacatatcactgtttcatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35208962 |
gaaaggattcaagtatatggtaccaaccttggctagttggcttcgtatctt---aacaactactcatcatttggagtgtccacatatcactgtttcagat |
35208866 |
T |
|
| Q |
101 |
ttaatggtcacaacttaactcagaagcaatgaaatatagagctaattaatggactctttgaccataacacaacgatagggatatttaatactccatgaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35208865 |
ttaatggtcacaacttaactcagaagcaatgaaatatggagctaattaatggactctttgaccataacacaaccataaggatatttaatactccatgaca |
35208766 |
T |
|
| Q |
201 |
tgcctacttggaagattaataaagatggtggttatatg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35208765 |
tgcctacttggaagattaataaagatggtggttatatg |
35208728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 66 - 115
Target Start/End: Original strand, 32208398 - 32208447
Alignment:
| Q |
66 |
atcatttggagtgtccacatatcactgtttcatatttaatggtcacaact |
115 |
Q |
| |
|
||||||||||||| ||||||||||| ||| || | ||||||||||||||| |
|
|
| T |
32208398 |
atcatttggagtggccacatatcaccgttgcagacttaatggtcacaact |
32208447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University