View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3564_low_15 (Length: 372)
Name: NF3564_low_15
Description: NF3564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3564_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 29072339 - 29072513
Alignment:
| Q |
12 |
agagagatatgagacagtacaagcgttacacgggtgttgccttgtttgtttggtaaccgaaatgagtaattacttttgcacaaaacatggaatttataat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29072339 |
agagagatatgagacagtacaagcgttacacgggtgttgccttgtttgtttggtaaccgaaatgagtaattacttttgcataaaacatggaatttataat |
29072438 |
T |
|
| Q |
112 |
gatacacacaagctatataaaccacttggcattggattgtggtgagctacatttgaagatgggtggttgagatat |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29072439 |
gatacacacaagctatataaaccacatggcattggattgtggtgagctacatttgaagatgggtggttgagatat |
29072513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 254 - 335
Target Start/End: Original strand, 29072581 - 29072662
Alignment:
| Q |
254 |
atagaaagtctagcatagataagttggtaaaaatattgtattagaattagatttgaaatccgaattctcaatttattcatgt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
29072581 |
atagaaagtctagcatagataagttggtaaaaatattgtattagaattagatttgaaatccgaatttttaatttatttatgt |
29072662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University