View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_high_10 (Length: 259)
Name: NF3565_high_10
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 10425326 - 10425498
Alignment:
| Q |
1 |
gagtgtaatcttgatgataacccatttctcatgggtgttctcctcttcagtgacacgatttcaagacggcttggcaggacgatt-caatcccgggtaatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
10425326 |
gagtgtaatcttgatgataacccatttctcatgggtgttctcctcttcagtgacacgatttcaagacggcttggcatgacgatttcaatcctgggtaatg |
10425425 |
T |
|
| Q |
100 |
agtgagtagaagtcttaattagaagcggattatattgtgtttctatgtgggaagatatttgacggttattaag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10425426 |
agtgagtagaagtcttaattagaagcggattatattgtgtttctatgtgggaagatatttgaaggttattaag |
10425498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 10426116 - 10426163
Alignment:
| Q |
200 |
ctaattggaacggtgaatgtaagaataatacctccaagcagattccta |
247 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10426116 |
ctaattggaacagtgaatgtaagaataatacctcccagcagattccta |
10426163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University