View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3565_high_16 (Length: 244)

Name: NF3565_high_16
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3565_high_16
NF3565_high_16
[»] chr7 (1 HSPs)
chr7 (15-238)||(4573288-4573511)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 4573511 - 4573288
Alignment:
15 tatcggtccaaatcgattgcagtcacaaaatgctgcagttggtaaatgtcaattgctaaataaagattggattctttgttttttaacttctaaaatccga 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
4573511 tatcggtccaaatcgattgcagtcacaaaatgctgcagttggtaaatgtcaattgctaaatagagattggattctttgttttttaacttctaaaatccga 4573412  T
115 taatcaacataccgtacccccgatattacaatccataggaaatgttagactgcataaaatgacagtgcatgctaattctttatttattggtgcttccatt 214  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4573411 taatcaacataccgtacgcccgatattacaatccataggaaatgttagactgcataaaatgacagtgcatgctaattctttatttattggtgcttccatt 4573312  T
215 tttgattgcttgtgttagacattg 238  Q
    ||||||||||||||||||||||||    
4573311 tttgattgcttgtgttagacattg 4573288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University