View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_high_16 (Length: 244)
Name: NF3565_high_16
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 15 - 238
Target Start/End: Complemental strand, 4573511 - 4573288
Alignment:
| Q |
15 |
tatcggtccaaatcgattgcagtcacaaaatgctgcagttggtaaatgtcaattgctaaataaagattggattctttgttttttaacttctaaaatccga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573511 |
tatcggtccaaatcgattgcagtcacaaaatgctgcagttggtaaatgtcaattgctaaatagagattggattctttgttttttaacttctaaaatccga |
4573412 |
T |
 |
| Q |
115 |
taatcaacataccgtacccccgatattacaatccataggaaatgttagactgcataaaatgacagtgcatgctaattctttatttattggtgcttccatt |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573411 |
taatcaacataccgtacgcccgatattacaatccataggaaatgttagactgcataaaatgacagtgcatgctaattctttatttattggtgcttccatt |
4573312 |
T |
 |
| Q |
215 |
tttgattgcttgtgttagacattg |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4573311 |
tttgattgcttgtgttagacattg |
4573288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University