View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_high_20 (Length: 235)
Name: NF3565_high_20
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_high_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 6 - 235
Target Start/End: Complemental strand, 4573707 - 4573486
Alignment:
| Q |
6 |
tatcctctgcacccagtgtagctccacataaatctatgcgtttcacgcagcttgctcatgtgtctagcgcagctggtagaaacaga---tcttgaaacat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
4573707 |
tatcctctgcacccagtgtagctccacataaatctatgcgtttcacgcagcttgctcgtgtgtctagcgcagcttgtagaaacagatcttcttgaaacat |
4573608 |
T |
|
| Q |
103 |
caacacagccgcacctagcgcagcagtccctacgcctagagcatgggacaaaacgccgtcatatttctccgactttcaacatatgatttcaagacacatc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4573607 |
caacacagccgcacctagcgcagcagtccctac-----------gggacaaaacgccgtcatatttctccgacattcaacatatgatttcaagacacatc |
4573519 |
T |
|
| Q |
203 |
tcaatattatcggtcccaatcgattgcagtcac |
235 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
4573518 |
tcaatattatcggtccaaatcgattgcagtcac |
4573486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University