View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_high_21 (Length: 233)
Name: NF3565_high_21
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 25773321 - 25773128
Alignment:
| Q |
24 |
tgaagtaaagcaaacttaacgtcatagctacgaaaaccagcttctgcaaaaaccctactaactataggatcatcaagaatagagagaatgaaatgcttca |
123 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25773321 |
tgaagtaaagcaaacttaacatcatagctacgaaaaccagcttctgcaaaaaccctactaactataggatcatcaagaatagagagaatgaaatgcttca |
25773222 |
T |
 |
| Q |
124 |
actcaactttcaaaaaggacgcagtttgattctggttttgttgctgttgctgcattatctgtagtaaatggaagctatctggatgacgacgttg |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25773221 |
actcaactttcaaaaacgacgcagtttgattctggttttgttgctgttgctgcattatctgtagtaaatggaagctatctggatgacgacgttg |
25773128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University