View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_high_23 (Length: 214)
Name: NF3565_high_23
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 41563658 - 41563856
Alignment:
| Q |
1 |
ggatgtgagaattttgacatgcttccatcaatgtccatggctcatactttcttcaaagtagcaaatacccttctacaagatcaagcagaagaagcttttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41563658 |
ggatgtgagaattttgacatgcttccatcaatgtctatggctcatactttcttcaaagtagcaaatacccttctacaagatcaagcagaagaagcttttg |
41563757 |
T |
 |
| Q |
101 |
aaaagttaacaccaaagccaagttgcataatctctgatgttggttttccttacacttctaaaattgcaacaaaattcaatattccaagaatttcttttt |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41563758 |
aaaagttaacaccaaaaccaagttgcataatctctgatgttggttttccttacacttctaaaattgcaacaaaattcaatattccaagaatttcttttt |
41563856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University