View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_high_9 (Length: 271)
Name: NF3565_high_9
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 25658919 - 25659158
Alignment:
| Q |
18 |
caccaattacccgcgttttgatttcactgcaagcaacttccgatgaacagcgccgcttattctgccggtgtctcaccgccgaatgaggccgatatcgatt |
117 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| ||| |||||||||| |||||||||| |
|
|
| T |
25658919 |
caccaattacacgcgttttgatttcattgcaa----cttccgatgaacagcgccgcttattctgccggagtctcgccgtcgaatgaggcggatatcgatt |
25659014 |
T |
|
| Q |
118 |
gggagatgcgtcccggcggtatgttcgtacagagacgcgaatcaggtgacgatgatcataccgatggacccatgatcaacatcagtgttgcatatggttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25659015 |
gggagatgcgtcccggcggtatgttcgtacagagacgcgaatcaggtgacgatgatcataccgacggaccgatgatcaacatcagtgttgcatatggttc |
25659114 |
T |
|
| Q |
218 |
ttctcagcatgaagtttatcttccagctcaatcctctttctgtg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25659115 |
ttctcagcatgaagtttatcttccagctcaatcctctttctgtg |
25659158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University