View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3565_low_14 (Length: 256)

Name: NF3565_low_14
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3565_low_14
NF3565_low_14
[»] scaffold0147 (1 HSPs)
scaffold0147 (9-241)||(20293-20525)


Alignment Details
Target: scaffold0147 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0147
Description:

Target: scaffold0147; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 20525 - 20293
Alignment:
9 gatgaagaagaggaagaggagaagaaattgaaggtttatttttgtagtaggacacattcgcagctttcacagtttgtaaaggagttgagaaagacagtgt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||    
20525 gatgaagaagaggaagaggagaagaaattgaaggtttatttttgtagtaggacacattcgcagctttcacagtttgtaaaggagttgaggaaaacggtgt 20426  T
109 ttgctgatgaaatgggtgttgtgagtttaggttccaggaaaaatctttgtattaatcaaggtatggaactttgcttaatctggaaagttattttttggtt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20425 ttgctgatgaaatgggtgttgtgagtttaggttccaggaaaaatctttgtattaatcaaggtatggaactttgcttaatctggaaagttattttttggtt 20326  T
209 tccttttgattacttgattatgatcatgttgtt 241  Q
    |||||||||||||||||||||||||||||||||    
20325 tccttttgattacttgattatgatcatgttgtt 20293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University