View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_low_14 (Length: 256)
Name: NF3565_low_14
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_low_14 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 9 - 241
Target Start/End: Complemental strand, 20525 - 20293
Alignment:
| Q |
9 |
gatgaagaagaggaagaggagaagaaattgaaggtttatttttgtagtaggacacattcgcagctttcacagtttgtaaaggagttgagaaagacagtgt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||| |
|
|
| T |
20525 |
gatgaagaagaggaagaggagaagaaattgaaggtttatttttgtagtaggacacattcgcagctttcacagtttgtaaaggagttgaggaaaacggtgt |
20426 |
T |
 |
| Q |
109 |
ttgctgatgaaatgggtgttgtgagtttaggttccaggaaaaatctttgtattaatcaaggtatggaactttgcttaatctggaaagttattttttggtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20425 |
ttgctgatgaaatgggtgttgtgagtttaggttccaggaaaaatctttgtattaatcaaggtatggaactttgcttaatctggaaagttattttttggtt |
20326 |
T |
 |
| Q |
209 |
tccttttgattacttgattatgatcatgttgtt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20325 |
tccttttgattacttgattatgatcatgttgtt |
20293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University