View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_low_4 (Length: 396)
Name: NF3565_low_4
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 15 - 378
Target Start/End: Complemental strand, 28336243 - 28335886
Alignment:
| Q |
15 |
cacagaccattttggggaacgagaaaaaaggcacaatatccactaaactgcgcactaaggatcatatcaacagaccgaccactatgagcaggaggagggt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28336243 |
cacaaaccattttggggaacgagaaaaaaggcacaatatccactaaactgcgcactaaggatcatatcaacagacc----actatgagcaggaggagggt |
28336148 |
T |
 |
| Q |
115 |
gaagttgaatgtgtaggatcttctgagcaagg-agttatcatgtacaatgtaaaattagtcgagagagggctcgtcactttaggccacaatgttcggcta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28336147 |
gaagttgaatgtgtaggatcttctgagcaagggagttatcatgtacaatgtaaaattagtcgagagagggctcgtcactttaggccacaatgttcggcta |
28336048 |
T |
 |
| Q |
214 |
attttgcataatttttgctataaaatactcggttcatacactataatagacacactcgatcaatcaaacgggctatttttgcatttttatccttttatca |
313 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28336047 |
attt-gcataatttttgctataaaatactcggttcatacactataatagacacactcgatcaatcaaacgagctatttttgcatttttatccttttatca |
28335949 |
T |
 |
| Q |
314 |
ttgtagctnnnnnnnctcagacaaccgtatctaacactctagtgtggaagttaggaaacccacat |
378 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28335948 |
-tgtagct-aaaaaactcaaacaaccgtatctaacactctagtgtggaagttagcaaacccacat |
28335886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University