View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3565_low_7 (Length: 344)
Name: NF3565_low_7
Description: NF3565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3565_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 8 - 154
Target Start/End: Original strand, 3662308 - 3662454
Alignment:
| Q |
8 |
aaacataggcagtgactttctgtgatatgaaactaaattgatgtgtactaaatagtgtagaagtgcacaaattctctgaccgatgataattcattgaatc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3662308 |
aaacattggcagtgactttctgtgatatgaaactaaattgatgtgtactaaatagtgtagaagtgcacaaattctctgaccgatgataattcattgaatc |
3662407 |
T |
 |
| Q |
108 |
aagttctccgatgcacattcagaataatttcatcccaattgcacatt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3662408 |
aagttctccgatgcacattcagaataatctcatcccaattgcacatt |
3662454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 218 - 330
Target Start/End: Original strand, 3662518 - 3662630
Alignment:
| Q |
218 |
ttatcagtctgcaactcttgccttctcagtctagagctattatttcccaccatctgataagaatttggcgggtggccgactactccggcaaaaatcatct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3662518 |
ttatcagtctgcaactcttgccttctcagtctagagctattatttcccaccatctgataagaatttggcgggtggccgactactccggaaaaaatcatct |
3662617 |
T |
 |
| Q |
318 |
cctcgaacattct |
330 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3662618 |
cctcgaacattct |
3662630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University