View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3566_low_11 (Length: 290)
Name: NF3566_low_11
Description: NF3566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3566_low_11 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 84
Target Start/End: Original strand, 54157870 - 54157939
Alignment:
| Q |
15 |
taggctaatatgaagaacctgaaaagagaagtatggaagcttttgaaaattgaaagaaataaaaagggtt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54157870 |
taggctaatatgaagaacctgaaaagagaagtatgaaagcttttgaaaattgaaagaaataaaaagggtt |
54157939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 97 - 160
Target Start/End: Original strand, 54157969 - 54158032
Alignment:
| Q |
97 |
agaataaaggaacgattattgcctggattgtcgtgggcttgaaaggagttaaaaacaccccacc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54157969 |
agaataaaggaacgattattgcctggattgtcgtgggcttgaaaggagttaaaaacaccccacc |
54158032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 205 - 269
Target Start/End: Original strand, 54158077 - 54158141
Alignment:
| Q |
205 |
aatgaagggtcaggatttggagcaagtctttatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54158077 |
aatgaagggtcaggatttggagcaagtctttatatatagggttttgctagaagacaccttttatg |
54158141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 6137250 - 6137284
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6137250 |
tatatatagggttttgctagaagacaccttttatg |
6137284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 8632 - 8598
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
8632 |
tatatatatggttttgctagaagacgccttttatg |
8598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 392396 - 392430
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
392396 |
tatatatagggttttgctagaagacaccttttatg |
392430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 12176372 - 12176338
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12176372 |
tatatatagggttttgctagaagacaccttttatg |
12176338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 12420800 - 12420766
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12420800 |
tatatatagggttttgctagaagacaccttttatg |
12420766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Original strand, 23472505 - 23472539
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23472505 |
tatatatagggttttgctagaagacaccttttatg |
23472539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 39590042 - 39590008
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39590042 |
tatatatagggttttgctagaagacaccttttatg |
39590008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 269
Target Start/End: Complemental strand, 21396030 - 21395996
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttatg |
269 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21396030 |
tatatatagggttttgctagaagacaccttttatg |
21395996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 268
Target Start/End: Original strand, 74975 - 75008
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgccttttat |
268 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
74975 |
tatatatagggttttgctagaagacgctttttat |
75008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 267
Target Start/End: Complemental strand, 41586029 - 41585997
Alignment:
| Q |
235 |
tatatatagggttttgctagaagacgcctttta |
267 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
41586029 |
tatatatagggttttgctagaagacacctttta |
41585997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University