View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3566_low_17 (Length: 243)
Name: NF3566_low_17
Description: NF3566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3566_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 12 - 146
Target Start/End: Original strand, 24614582 - 24614716
Alignment:
| Q |
12 |
acagacttaataatgtaatcatgcaattcttgttgagttcctcatggaactgttaattaaatttaacggtcgtcgatcgttatggttaatgctagaaata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24614582 |
acagacttaataatgtaatcatgcaatttttgttgagttcctcatggaactgttaattaaatttaacggtcgtcgatcgttatggttaatgctagaaata |
24614681 |
T |
 |
| Q |
112 |
tgaatttagcttcgtgagtttaactcaattgatag |
146 |
Q |
| |
|
||||||| |||||||||||||||| ||||||| |
|
|
| T |
24614682 |
tgaatttgatctcgtgagtttaactcagttgatag |
24614716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University