View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3567_high_10 (Length: 295)
Name: NF3567_high_10
Description: NF3567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3567_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 277
Target Start/End: Complemental strand, 47140038 - 47139774
Alignment:
| Q |
13 |
aatatcttgatatctctaaagattgcttcgtccacaattgcacttactttgcctatcaccagagccacccaccactctgctgcctcacaaccactatcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47140038 |
aatatcttgatatctctaaagattgcctcgtccacaattgcacttactttgcctatcaccagagccacccaccactctgctgcctcacaaccactatcat |
47139939 |
T |
 |
| Q |
113 |
gtctttcgcttgttgtttctcgaccgcggcctgctgaaccctctgcttggactcctcggtgcaacccattttccctttataaataaagtgtttgatttac |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
47139938 |
gtctttcgcttgttgttcctcgaccgcggcctgctgaaccctctgcttggactcctcggtgcaacctatcttccctttataaataaagtgtttgatttac |
47139839 |
T |
 |
| Q |
213 |
tgtttaatcacagcaacaaacgtgcatttgttccagattaagcaatctgtggaccaaagcaattt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47139838 |
tgtttaatcacagcaacaaacgtgcatttgttccagattaagcaatttgtggaccaaagcaattt |
47139774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University