View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3567_high_17 (Length: 236)
Name: NF3567_high_17
Description: NF3567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3567_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46354284 - 46354508
Alignment:
| Q |
1 |
atggaattaattgaaaactacaaattataccgtttcttcaataaattgggcttaaaattttatgaaaaatgtcatatggaatcaaaactttaatgtcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354284 |
atggaattaattgaaaactacaaattataccgtttcttcaataaattgggcttaaaattttatgaaaaatgtcatatggaatcaaaactttaatgtcaaa |
46354383 |
T |
|
| Q |
101 |
tactgagttatttggtttgtaaacannnnnnnnnnnaagtaatctagtgtccgatc----atgttggacgtgtttatattttgatgataaaaatatatag |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354384 |
tactgagttatttggtttgtaaacattttttttgttaagtaatttagtgtccgatcgattatattggacgtgtttatattttgatgataaaaatatatag |
46354483 |
T |
|
| Q |
197 |
ctcaatttttacattttattgattc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46354484 |
ctcaatttttacattttattgattc |
46354508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University