View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3567_low_13 (Length: 282)
Name: NF3567_low_13
Description: NF3567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3567_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 35095628 - 35095373
Alignment:
| Q |
17 |
accttaaaggcaacattgacatcgattccatcaaggatttaccgtatatcagaaccattagcttaatgaacaaccaattcgataccacatggccaggcct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095628 |
accttaaaggcaacattgacatcgattccatcaaggatttaccgtatatcagaaccattagcttaatgaacaaccaattcgataccacatggccaggcct |
35095529 |
T |
 |
| Q |
117 |
aaacaaactcaccggtcttaagaacatttacctttctaataataaattctctggcgagattccagcagaggcgtttcaagcgatgcagtggctgaagaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095528 |
aaacaaactcaccggtcttaagaacatttacctttctaataataaattctctggcgagattccagcagaggcgtttcaagcgatgcagtggctgaagaaa |
35095429 |
T |
 |
| Q |
217 |
atttatctcgacaataatcagttcactggtcctattccaacttcccttgcttcatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095428 |
atttatctcgacaataatcagttcactggtcctattccaacttcccttgcttcatt |
35095373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University