View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3567_low_16 (Length: 248)
Name: NF3567_low_16
Description: NF3567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3567_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 43842949 - 43842707
Alignment:
| Q |
1 |
catgaggtttgagtagtgatgttgatgaatcttcttcttctttggtttgggtggactcaataccaaaacacctcaaaaaagtcttgaaaatttcttcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43842949 |
catgaggtttgagtagtgatgttgatgaatcttcttcttctttggtttgcgtggactcaataccaaaacacctcaaaaaagtcttgaaaatttcttcaag |
43842850 |
T |
 |
| Q |
101 |
acaatagcatggatggtaaacatagaaagccattgttttctcttctttcttagttgataatctctccgtagtttcttccatgtgtttcacaattaatctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43842849 |
acaatagcatggatggtaaacatagaaagtcattgttttctcttctttcttagttgataatctctccgtagtttcttccatgtgtttcacaattaatctc |
43842750 |
T |
 |
| Q |
201 |
ttgtgcttgattttgctaaattttagtgattgtctctgctcct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43842749 |
ttgtgcttgattttgctaaattttagtgattgtttctgttcct |
43842707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University