View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3568_low_14 (Length: 220)
Name: NF3568_low_14
Description: NF3568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3568_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 24009551 - 24009754
Alignment:
| Q |
1 |
cctcatgtacataagttcaccctcttgttctgatccattatcagtccctggtataacaccagcacccattgaaattggctccacagctttgagaatatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24009551 |
cctcatgtacataagttcaccctcttgttctgatccattatcagtccctggtataacaccagcacccattgaaattggctccacagctttgagaatatcc |
24009650 |
T |
|
| Q |
101 |
cactccttttgtccgcattctcttctgttagcgaatccgcatttcttgccattgcaatatgtcctccactgaggctcttcaagcaaccttaaggttttct |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24009651 |
cactccttttgtccacattctcttctgttagcaaatccgcatttcttgccattgcaatatgtcctccactgaggctcttcaagcaaccttaaggttttct |
24009750 |
T |
|
| Q |
201 |
tctc |
204 |
Q |
| |
|
|||| |
|
|
| T |
24009751 |
tctc |
24009754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 55 - 168
Target Start/End: Complemental strand, 46089763 - 46089650
Alignment:
| Q |
55 |
aacaccagcacccattgaaattggctccacagctttgagaatatcccactccttttgtccgcattctcttctgttagcgaatccgcatttcttgccattg |
154 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| | ||| ||||| || |||| || ||||||||||| ||| | ||||| || || || ||||| |
|
|
| T |
46089763 |
aacaccagcacccattgaaataggctcaacagctttcaaaatctcccaatctttttcaccacattctcttctattaccaaatccacacttttttccatta |
46089664 |
T |
|
| Q |
155 |
caatatgtcctcca |
168 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
46089663 |
caataagtcctcca |
46089650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University