View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3569_high_3 (Length: 417)
Name: NF3569_high_3
Description: NF3569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3569_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 1 - 407
Target Start/End: Original strand, 6527732 - 6528137
Alignment:
| Q |
1 |
ataaactattgtttgagattgttggtagtattgagactctaatcgttttatatacagccacgacgggtcaaacattcgaccattttgcaattgtccttt- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6527732 |
ataaactattgtttgagattgttggtagtattgagactctaatcgttttatatacagccacgacgggtcaaacattcgaccattttgcaattgtcctttt |
6527831 |
T |
|
| Q |
100 |
atgacattagtgtcacaagaaaattgcctaataaaatcaatatggtgcaacaagaggattttgcttttgagtgttgctatatatatagcgaacactcttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
6527832 |
atgacattagtgtcacaagaaaattgcctaataaaatcaatatggtgcaacaagaggattttgcttttgagtgttgctata--tatagcgaacacacttt |
6527929 |
T |
|
| Q |
200 |
cacaatgcattgcgaacgtagcatcaccattggatcttcatatcacacaatacatgggtggttggaactaagtactagaattcgctcagtacacatgtca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
6527930 |
cacaatgcattgcgaacgtagcatcaccattggatcttcatatcacacaatacatgggtggttggaactaagtactagaatttgctcaatacacatgtca |
6528029 |
T |
|
| Q |
300 |
gtgtcgggatatcctcgggacaaatttttcgctatatgtagcattaacctttgcttttatatcggcgaatatgaaagacttcattctatttgctctcatt |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6528030 |
gtgtcgggatatcctcgggacaaatttttcgctatatgtagcattaacctttgcttttatatcggcgaatatgaaagacttcattctatttgctctcatt |
6528129 |
T |
|
| Q |
400 |
gttatatt |
407 |
Q |
| |
|
|||||||| |
|
|
| T |
6528130 |
gttatatt |
6528137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University