View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3569_high_5 (Length: 279)
Name: NF3569_high_5
Description: NF3569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3569_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 99 - 262
Target Start/End: Original strand, 33219891 - 33220054
Alignment:
| Q |
99 |
gtcatcatccatgggccatccatcatcgtcatcatgatggatgagcttcacgatgagcctaccattttctcgattcgcttccatatgctcataataacgc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33219891 |
gtcatcatccatgggccatccatcatcgtcatcatgatggatgagcttcacgatgagcctaccattttctctattcgcttccatatgctcataataacgc |
33219990 |
T |
|
| Q |
199 |
ttcactttccccacctttaaaatcaaccttccatcttcaccatattccttcttaaaacacgaag |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33219991 |
ttcactttccccacctttaaaatcaaccttccatcttcaccatattccttcttaaaacacgaag |
33220054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 54472003 - 54472059
Alignment:
| Q |
18 |
agtcatcacaggctccacctaacaactcaccattgcctccgaaccagggtgtctttt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54472003 |
agtcatcacaggctccacctaacaactcaccattgcctccaaaccagggtgtctttt |
54472059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University