View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3569_high_7 (Length: 249)
Name: NF3569_high_7
Description: NF3569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3569_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 35095595 - 35095373
Alignment:
| Q |
17 |
aggatttaccgtatatcagaaccattagcttaatgaacaaccaattcgataccacatggccaggcctaaacaaactcaccggtcttaagaacatttacct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095595 |
aggatttaccgtatatcagaaccattagcttaatgaacaaccaattcgataccacatggccaggcctaaacaaactcaccggtcttaagaacatttacct |
35095496 |
T |
 |
| Q |
117 |
ttctaataataaattctctggcgagattccagcagaggcgtttcaagcgatgcagtggctgaagaaaatttatctcgacaataatcagttcactggtcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35095495 |
ttctaataataaattctctggcgagattccagcagaggcgtttcaagcgatgcagtggctgaagaaaatttatctcgacaataatcagttcactggtcct |
35095396 |
T |
 |
| Q |
217 |
attccaacttcccttgcttcatt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35095395 |
attccaacttcccttgcttcatt |
35095373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University