View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3569_low_9 (Length: 229)

Name: NF3569_low_9
Description: NF3569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3569_low_9
NF3569_low_9
[»] chr2 (1 HSPs)
chr2 (1-229)||(33387268-33387496)


Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 33387496 - 33387268
Alignment:
1 aaaattatgataagaatagaggacaaaaacttagggattctaagaaattgccacctttgatgaactatgatggaattggaaagcatggttatgagttaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33387496 aaaattatgataagaatagaggacaaaaacttagggattctaagaaattgccacctttgatgaactatgatggaattggaaagcatggttatgagttaag 33387397  T
101 aagaagttgcaatgaatgtgccatttgtttggaagattttcaaaggggacaattgtgtcaagtttttcctgtttgcaagcacatttttcattcagattgt 200  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
33387396 aagaagttgcaatgaatgcgccatttgtttggaagattttcaaaggggacagttgtgtcaagtttttcctgtttgcaagcacatttttcattcagattgt 33387297  T
201 atagatcattggttgcagaggaacttaac 229  Q
    ||||||||||||||||||||||| |||||    
33387296 atagatcattggttgcagaggaaattaac 33387268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University