View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_high_22 (Length: 355)
Name: NF3570_high_22
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_high_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 19 - 355
Target Start/End: Original strand, 29066392 - 29066729
Alignment:
| Q |
19 |
aaggtgcatgtcgaaaaatgaaaaccagtcttcatctgcaacagctgatgaaagataagagaaaa-cttcaccttttactatatttttctcttttgagat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29066392 |
aaggtgcatgtcgaaaaatgaaaaccagtcttcatctgcaacagctgatgaaagataagagaaaaacttcacctttcactatatttttctcttttgagat |
29066491 |
T |
|
| Q |
118 |
agactagttgtgtttttcgtaactcttgattgatatcacggtgacaaccgcactttaggagcgaagctccaatctgttgcttgggataaaaacaacggcg |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29066492 |
agactagctgtgtttttcgtaactcttgattgatatcacggtgacaaccgcactttaggagcgaagctccaatctgttgcttgggataaaaacaacggtg |
29066591 |
T |
|
| Q |
218 |
aagacgcgagaaacgcctatgctagctacagctggtggatgagctggttatgaaaaagggaggcaaaagaaggggactataaattttacatgttctcttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29066592 |
aagacgcgagaaacgcctatgctagctacagcttgtggatgagctggttatgaaaaagggaggcaaaagaaggggactataaattttacatgttctcttt |
29066691 |
T |
|
| Q |
318 |
gttgcaaattgttgttgctgctaaatccccaaagtttc |
355 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29066692 |
gttgcaaattgttgttgccgctaaatccccaaagtttc |
29066729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University