View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_high_25 (Length: 327)
Name: NF3570_high_25
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 12 - 308
Target Start/End: Complemental strand, 7680092 - 7679796
Alignment:
| Q |
12 |
agagatattcatcataaggtttattctatcaggataaaatcaagctgcaaggatgtgaactcgaggaaccattgactcttttgtttaaggggaagaataa |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7680092 |
agagatattcatcataagttttattctatcaggataaaatcaagctgcaaggatgtgaactcgaggaaccattgactcttttgtttaaggggaagaataa |
7679993 |
T |
 |
| Q |
112 |
gctcaatatcccaagttttatgacggaaggtgagaatgaaatcgaaaggcctaggagcataagccctccaagaaccttctctggttctagtgggcaacct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
7679992 |
gctcaatatcccaagttttatgacggaaggtgagaatgagatcgaaaggcctaggagcagaagccctccaagaaccttctatggttctagcgggcaacct |
7679893 |
T |
 |
| Q |
212 |
acacggtatcccagagcgacctttactactccttctagtgctgccacgacatcgtattccattccgacctttgctattgatccctatgaagaatgta |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7679892 |
acacggtatcccagagcgacctttactactccttctagtgctgccacgacatcgtattccagtccgacctttgttattgatccctatgaagaatgta |
7679796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University