View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_high_28 (Length: 286)
Name: NF3570_high_28
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 12622316 - 12622268
Alignment:
| Q |
18 |
cttagtatatctctgtaatgcatcaatcaattataataacgatcatcaa |
66 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12622316 |
cttagtatatctctgtgatgcatcaatcaattataataacgatcatcaa |
12622268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University