View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_high_44 (Length: 227)
Name: NF3570_high_44
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 4328884 - 4329104
Alignment:
| Q |
1 |
gaccgtgtctgtctttaacggggctggatatcatatacttccaacatcctggtagtattaacaatatgagacttcaatgcaacttcaatatcgaccagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328884 |
gaccgtgtctgtctttaacggggctggatatcatatacttccaacatcctggtagtattaacaatatgagacttcaatgcaacttcaatatcgaccagac |
4328983 |
T |
 |
| Q |
101 |
tcctagtggcgtgcggtatggtccaatttccacattttcatccctcttgacaggcaaagtcaaaatactgcaattgtccttcttacctttaagacaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4328984 |
tcctagtggcgtgcggtatggtccaatttccacattttcatccctcttgacaggcaaagtcaaaatactgcaattgtccttcttacctttaagacaaagg |
4329083 |
T |
 |
| Q |
201 |
tctcataaacaagatctttca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4329084 |
tctcataaacaagatctttca |
4329104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 42 - 153
Target Start/End: Complemental strand, 4498946 - 4498839
Alignment:
| Q |
42 |
caacatcctggtagtattaacaatatgagacttcaatgcaacttcaatatcgaccagactcctagtggcgtgcggtatggtccaatttccacattttcat |
141 |
Q |
| |
|
||||||| ||||| | ||||||||| ||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
4498946 |
caacatcgtggtaatcttaacaatacgagacttcaatacaacttcaatatcgaccagactcctagcg----gcggtatggtccaattcccacattttcat |
4498851 |
T |
 |
| Q |
142 |
ccctcttgacag |
153 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4498850 |
ccctcttgacag |
4498839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University