View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_low_24 (Length: 343)
Name: NF3570_low_24
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 37117257 - 37116931
Alignment:
| Q |
1 |
tttccttggtgggttttctgttaaaagaacaaagacaatgatgcatgtggttgatcacaatcaaagtcaagtgggtagtggtggtgatgtctctcatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37117257 |
tttccttggtgggttttctgttaaaagaacaaagacaatgatgcatgtggttgatcacaatcaaagtcaagtgggtagtggtggtgatgtctctcatgga |
37117158 |
T |
 |
| Q |
101 |
ttgcataaagatttggtctcccttccaagtgggtagtttcatcttctatatcttttgtttataatttacttgcttcaagattattactttaggaggagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37117157 |
ttgcataaagatttggtctcccttccaagtgggtagtttcatcttctatatcttttgtttataatttacttgcttcaagattattactttaggaggagta |
37117058 |
T |
 |
| Q |
201 |
ttgtttaaggaaccttgttaaatgtttttgataattgaattgaatttgaatatttatttgactatatggtggatttagtttattctatttttggttgctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37117057 |
ttgtttaaggaaccttgttaaatgtttttgataattgaattgaatttgaatatttatttgactatatagtggatttagtttattctatttttggttgctt |
37116958 |
T |
 |
| Q |
301 |
gatttgtatactttgaatgaataaattg |
328 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
37116957 |
gatttgtatac-ttgaatgaataaattg |
37116931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University