View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_low_33 (Length: 256)
Name: NF3570_low_33
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 47424200 - 47424335
Alignment:
| Q |
1 |
tgagtaaaaagaatttttacaaaactcttatggtaagacttgacttattatcactnnnnnnntccaacaatatcgtttaaaatcacatttggagaacaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
47424200 |
tgagtaaaaagaatttttacaaaactcgtatagtaagacttgacttattatcactaaaaaaatccaacaaaatcatttaaaatcatatttggagaacaat |
47424299 |
T |
 |
| Q |
101 |
ctatcaaaatttaaccgttattgtacaatataaggt |
136 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47424300 |
ctatcaaaatttaaccattattgtacaatataaggt |
47424335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 239
Target Start/End: Original strand, 47424403 - 47424438
Alignment:
| Q |
204 |
tacttcctaattacatccatccctatactttcatct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424403 |
tacttcctaattacatccatccctatactttcatct |
47424438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University