View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3570_low_50 (Length: 216)
Name: NF3570_low_50
Description: NF3570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3570_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 40053132 - 40052965
Alignment:
| Q |
18 |
tataaactattaaataataatttaatctaaggagatcctggtgtaaggttgacttttccttaatgatatcagtctaatacgtaggctaatgctatactgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40053132 |
tataaactattaaataataatttaatctaaggagatcctggtgtaagattgacttttccttaatgatatcagtctaatacgtaggctaatgctatactgg |
40053033 |
T |
 |
| Q |
118 |
caatactgtaatgccagcggactgagtataacagagtaaatgaagtaatagttagtagtatgataatg |
185 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40053032 |
caatactgtaatgccagcagactgaggataacagagtaaatgaagtaatagttagtagtatgataatg |
40052965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University