View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3572_low_15 (Length: 291)
Name: NF3572_low_15
Description: NF3572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3572_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 20 - 279
Target Start/End: Complemental strand, 6485885 - 6485626
Alignment:
| Q |
20 |
tactctgcttcatgggacagaaccgtcaaagtttggagaatcgccgattcaaagtgcttggaatccattacttcccatgaggatgcagttaacgccgtcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485885 |
tactctgcttcatgggacagaaccgtcaaagtttggagaatcgccgattcaaagtgcttggaatccattacttcccatgaggatgcagttaacgccgtcg |
6485786 |
T |
 |
| Q |
120 |
tttgtggaaacgacggaattgttttctctggttcagcagacggaacagttaaagtgtggcgaagagaaccacgtggtaaagcaacaaaacatgtaatggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485785 |
tttgtggaaacgacggaattgttttctctggttcagcagacggaacagttaaagtgtggcgaagagaaccacgtggtaaagcaacaaaacatgtaatggt |
6485686 |
T |
 |
| Q |
220 |
taaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485685 |
taaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttc |
6485626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University