View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3572_low_19 (Length: 269)
Name: NF3572_low_19
Description: NF3572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3572_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 37980191 - 37979978
Alignment:
| Q |
18 |
caaaattcaaattatcaaaaggatcttggattatatctaggtgctccaatgcttcattaaaaggattctaaatctggttaagagtttattcttgacaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37980191 |
caaaattcaaattatcaaaaggatcttggattatatctaggtgctccaatgcttcattaaaaggattctaaatctggttaagagtttattcttgacaaaa |
37980092 |
T |
|
| Q |
118 |
tgagaaggaaattatgaggttggaaagcgaattccctctcttttgctgtaatgagattactcttgctcaatcttccttacctatcattcctgagtatgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37980091 |
tgagaaggaaattatgaggttggaaagcgaattccctctcttttgctggaatgagattactcttgctcaatcttccttacctatcattcctgagtatgtg |
37979992 |
T |
|
| Q |
218 |
atccaatcaactag |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37979991 |
atccaatcaactag |
37979978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University