View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3572_low_26 (Length: 229)
Name: NF3572_low_26
Description: NF3572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3572_low_26 |
 | |
|
| [»] scaffold0054 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 24415382 - 24415238
Alignment:
| Q |
1 |
aaaagcaaaatagtaaattggaaacaaaccaaaactaaaactgtcactttcttattatgagccttttttcatcttccaaggtagtattattatacttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24415382 |
aaaagcaaaatagtaaattggaaacaaaccaaaactaaaactgtcactttcttattatgacccttttttcatcttccaaggtagtattattatacttatt |
24415283 |
T |
|
| Q |
101 |
tatttttgatgcatttcccgttttcattttggtactagcctatga |
145 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24415282 |
tatttttgatgcatttcccgttatcattttggtactagcctatga |
24415238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 77 - 144
Target Start/End: Complemental strand, 42546 - 42480
Alignment:
| Q |
77 |
caaggtagtattattatacttatttatttttgatgcatttcccgttttcattttggtactagcctatg |
144 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546 |
caaggtagtagtattatacttatttattttt-atgcatttcccgttttcattttggtactagcctatg |
42480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 55
Target Start/End: Complemental strand, 38206 - 38163
Alignment:
| Q |
12 |
agtaaattggaaacaaaccaaaactaaaactgtcactttcttat |
55 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
38206 |
agtaaattggaaacaaacacaaattaaaactgtcactttcttat |
38163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University