View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3572_low_27 (Length: 223)
Name: NF3572_low_27
Description: NF3572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3572_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 45 - 203
Target Start/End: Complemental strand, 9355440 - 9355282
Alignment:
| Q |
45 |
cattttaattgaagcagaagccatcatagtcatttgtggggaggaacagggtaaagatgggctttgtgacaatatgcaacagccataatcttccattata |
144 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9355440 |
cattttaattgaagcaaaagccatcatagtcatttgtggggaggaacggggtaaagatgggctttgtgacaatatgcaacagccataatcttccattata |
9355341 |
T |
|
| Q |
145 |
gtggcagcaatagcaccagactgctgtagttggaaaacgtggcgcgtggaagttctgta |
203 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9355340 |
gtggcagcaatagcaccagattactgtagttggaaaacgtggcgcgtggaagttctgta |
9355282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 45 - 203
Target Start/End: Complemental strand, 9346030 - 9345872
Alignment:
| Q |
45 |
cattttaattgaagcagaagccatcatagtcatttgtggggaggaacagggtaaagatgggctttgtgacaatatgcaacagccataatcttccattata |
144 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9346030 |
cattttaattgaagcaaaagccatcatagtcatttgtggggaggaacggggtaaagatgggctttgtgacaatactcaacagccataatcttccattata |
9345931 |
T |
|
| Q |
145 |
gtggcagcaatagcaccagactgctgtagttggaaaacgtggcgcgtggaagttctgta |
203 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9345930 |
gtggcagcaatagcaccagattactgtagttggaaaacgtggcgcgtggaagttctgta |
9345872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University