View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3572_low_29 (Length: 212)
Name: NF3572_low_29
Description: NF3572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3572_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 24850242 - 24850057
Alignment:
| Q |
10 |
tcgaagaatataccactccagaatcagctgtgtttctactaatttttgaattttgacaaataaatttacttagatcagttactatgttgtatcagatcaa |
109 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850242 |
tcgaataaaataccactccagaatcagctgtgtttctactaatttttgaattttgacaaataaatttacttagatcagttactatgttgtatcagatcaa |
24850143 |
T |
 |
| Q |
110 |
ggtagcatgnnnnnnnagaggatctgcaaggtagcatgttcctttggttcttgctgttgtttgatttagaatttgtttctctattt |
195 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850142 |
ggtagcatgtttttttagaggatctgcaaggtagcatgttcctttggttcttgctgttgtttgatttagaatttgtttctctattt |
24850057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University