View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3575_low_15 (Length: 249)
Name: NF3575_low_15
Description: NF3575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3575_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 50994077 - 50994319
Alignment:
| Q |
1 |
tgcaaatgctcttgggagaattgctgataaattgtaaggttggatcgtaggtttagagttagttaacatttcgagtcaacaatagtcgatcccttcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
50994077 |
tgcaaatgctcttgggagaattgctgataaattgtaaggttggatcgtaggtttagagttagttaacatttcgagtcaacaatagtgggtcccttcatta |
50994176 |
T |
 |
| Q |
101 |
tttttcagtcacattttgcc-------nnnnnnnnnnagtgttattttgattattatactatgtcaccattaaacatttctcccattatatgtttgtttt |
193 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50994177 |
tttttcactcacattttgcccttttttttttttttttagtgttattttgattattatactatgtcaccattaaacatttctcccattatatgtttgtttt |
50994276 |
T |
 |
| Q |
194 |
attagttgttcaggatcatgatggtaaggtcactaaagtgttc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50994277 |
attagttgttcaggatcatgatggtaaggtcactaaagtgttc |
50994319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University