View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3575_low_17 (Length: 246)
Name: NF3575_low_17
Description: NF3575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3575_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 29820446 - 29820266
Alignment:
| Q |
1 |
tttcaatgtataggtttctctctctccgcttggatggtcgagttggtgggagtggtgttggttatcccctttggaatgctttctttgcacaattaccgcc |
100 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||| |||| ||||||||||||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
29820446 |
tttcaatgtataggtatctctctctacgcttggatggtcgagttcgtggaagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgcc |
29820347 |
T |
|
| Q |
101 |
ggtaaagggaatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaaggatga |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820346 |
ggtaaagggaatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaaggatga |
29820266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 198 - 234
Target Start/End: Complemental strand, 29820255 - 29820219
Alignment:
| Q |
198 |
atatacttctcccccttatacaaggagttcagcccta |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29820255 |
atatactcctcccccttatacaaggagttcagcccta |
29820219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University