View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3575_low_20 (Length: 237)
Name: NF3575_low_20
Description: NF3575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3575_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 50994037 - 50993811
Alignment:
| Q |
1 |
ttctgttgctggcgatccaactgtaaactcttgttccgagcctctagctgttcacatagcatcttgccatttttctctaacacttgaattaattcacttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50994037 |
ttctgttgctggcgatccaactgtaaactcttgttccgagcctctagctgttcacatagcatcttgccatttttctctaacactttaattaattcacttt |
50993938 |
T |
 |
| Q |
101 |
gcacactttcctcctcttc---------attgccttcagttgcaaccccccgcttcctctttcgttcacctgcttgtttctcattgatggcattgccttc |
191 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50993937 |
gcacactttcctcctcttcctcttcaatattgccttcagttgcaaccccccgcttcctctttcgttcacctggttgtttctcattgatggcattgccttc |
50993838 |
T |
 |
| Q |
192 |
tccttgtaagccactgaggagtggaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50993837 |
tccttgtaagccactgaggagtggaat |
50993811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 6523702 - 6523826
Alignment:
| Q |
1 |
ttctgttgctggcgatccaactgtaaactcttgttccgagcctctagctgttcacatagcatcttgccatttttctctaacacttgaattaattcacttt |
100 |
Q |
| |
|
||||| ||||| |||||||| || ||| | ||||| |||||||||| ||||||| |||||| || ||||||||||| ||||| | |||||||| ||| | |
|
|
| T |
6523702 |
ttctgctgctgccgatccaattgaaaattgatgttctgagcctctagttgttcacttagcattttcccatttttctccaacacatcaattaattgactat |
6523801 |
T |
 |
| Q |
101 |
gcacactttcctcctcttcattgcc |
125 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
6523802 |
gcaaactttcctcctcttcattgcc |
6523826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University