View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3575_low_7 (Length: 383)
Name: NF3575_low_7
Description: NF3575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3575_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 142 - 267
Target Start/End: Original strand, 375402 - 375529
Alignment:
| Q |
142 |
tgtcgtgtaatcgtgtcatggaatttgtgtggttgtgttgtgttggatacgattcgtgt--gggtttgtcacaaaacaccttggttcatccttaatttac |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
375402 |
tgtcgtgtaatcgtgtcatggaagttgtgtggttgtgttgtgttggatacgattcgtgtgtgggtttgtaacaaaacaccttggttcatccttaatttac |
375501 |
T |
|
| Q |
240 |
gataactaccattgttataattattcaa |
267 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
375502 |
gataactaccattgttatatttattcaa |
375529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 375260 - 375313
Alignment:
| Q |
1 |
ttttgttgaagaattttcagagaaatgaggggtttataagaaattagggttacg |
54 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
375260 |
ttttgttgaagaattttcagagaaattaggggtttataagaaattagggttacg |
375313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 316 - 365
Target Start/End: Original strand, 375554 - 375603
Alignment:
| Q |
316 |
taacaaattcagccaactatgtttatgtttccgatgacactattaataaa |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375554 |
taacaaattcagccaactatgtttatgtttccgatgacactattaataaa |
375603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University