View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3576_high_23 (Length: 354)

Name: NF3576_high_23
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3576_high_23
NF3576_high_23
[»] chr3 (2 HSPs)
chr3 (19-70)||(29394633-29394684)
chr3 (254-299)||(29394868-29394913)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 29394633 - 29394684
Alignment:
19 aagatgtgtagagatctgtgtttatgtctttgctaaagaataataatatgat 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
29394633 aagatgtgtagagatctgtgtttatgtctttgctaaagaataataatatgat 29394684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 254 - 299
Target Start/End: Original strand, 29394868 - 29394913
Alignment:
254 cactcactctctctctacaataaccatgttattgttccaacattgc 299  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
29394868 cactcactctctctctacaataaccatgttattgttccaacattgc 29394913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University