View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_23 (Length: 354)
Name: NF3576_high_23
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 29394633 - 29394684
Alignment:
| Q |
19 |
aagatgtgtagagatctgtgtttatgtctttgctaaagaataataatatgat |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29394633 |
aagatgtgtagagatctgtgtttatgtctttgctaaagaataataatatgat |
29394684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 254 - 299
Target Start/End: Original strand, 29394868 - 29394913
Alignment:
| Q |
254 |
cactcactctctctctacaataaccatgttattgttccaacattgc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29394868 |
cactcactctctctctacaataaccatgttattgttccaacattgc |
29394913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University