View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_30 (Length: 309)
Name: NF3576_high_30
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 13267313 - 13267038
Alignment:
| Q |
19 |
acaatcgacgtatggattggcttatggtcatgaattcttgacttgtttctgagaatatcttttcttaatagctcgcagtactttaatgaaatattgaatt |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13267313 |
acaatcaacgtatggattggcttatggtcatgaattcttgacttgtttctgagaatatcttttgctaatagctcacagtactttaatgaaatattgaatt |
13267214 |
T |
 |
| Q |
119 |
tttatgcatttatatagtcatgaattctgtcttgattgatttgtactttcttttgagattaaaaattattagttattatcttcactatgcagaccgacac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13267213 |
tttatgcatttatatagtcatgaattctgtcttgattgatttgtactttcttttgaaattaaaaattattagttattatcttcactatgcagaccgacac |
13267114 |
T |
 |
| Q |
219 |
caaaaagatatctgcagtctctatattttttgagacaatgccatatagattggatgaaagcacaggatacattgat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13267113 |
caaaaagatatctgcagtctctatattttttgagacaatgccatatagattggatgaaagcacaggatacattgat |
13267038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 204 - 281
Target Start/End: Original strand, 28324626 - 28324703
Alignment:
| Q |
204 |
tatgcagaccgacaccaaaaagatatctgcagtctctatattttttgagacaatgccatatagattggatgaaagcac |
281 |
Q |
| |
|
||||||||| |||||||| |||||||| || || |||||||| ||||| ||||||||||| || |||||||| ||||| |
|
|
| T |
28324626 |
tatgcagactgacaccaagaagatatcagctgtatctatattctttgaaacaatgccatacaggttggatgagagcac |
28324703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University